Review





Similar Products

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-50-0-5
Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-53-0-5
Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg
Tiparp Primers Forward Tgtttg Gccgtgacaggata Reverse Gcatgctttccacagcatcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-51-0-6
Average 86 stars, based on 1 article reviews
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg
Actb Primers Forward Actcttccagccttccttcc Reverse Tctccttctgcatcctgtcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/actin+%CE%B2/pmc13145899-54-0-5
Average 86 stars, based on 1 article reviews
actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech cdkn1b primers forward cttcttcgtcagcctcccttcc reverse gagtcgcagagccgtgagc
Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
Cdkn1b Primers Forward Cttcttcgtcagcctcccttcc Reverse Gagtcgcagagccgtgagc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/cdkn1c/pmc13145899-49-0-5
Average 86 stars, based on 1 article reviews
cdkn1b primers forward cttcttcgtcagcctcccttcc reverse gagtcgcagagccgtgagc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene oligonucleotides m eef1a forward reverse
Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
Oligonucleotides M Eef1a Forward Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/Eef1a1+(NM_175838)+Rat+Untagged+Clone/10__1016_slash_j__celrep__2026__117140-316-172-178
Average 94 stars, based on 1 article reviews
oligonucleotides m eef1a forward reverse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
New England Biolabs forward reverse primers
Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
Forward Reverse Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/Q5+High-Fidelity+DNA+Polymerase/10__3390_slash_microorganisms14030516-69-29-44
Average 99 stars, based on 1 article reviews
forward reverse primers - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
ATCC virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus
Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
Virus Forward Primer Reverse Primer Length Bp Rice Dwarf Virus Cgatcccgggaat Tcgga Ccgaattcccggg Atcc 525 Rice Stripe Virus, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/rice+dwarf+virus/10__1094_slash_pdis___06___25___1330___re-280-29-42
Average 94 stars, based on 1 article reviews
virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and CDKN1B proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.

Journal: iScience

Article Title: Integrated study reveals molecular mechanisms by which bisphenol A promotes ovarian cancer

doi: 10.1016/j.isci.2026.115768

Figure Lengend Snippet: Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and CDKN1B proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.

Article Snippet: CDKN1B primers Forward:CTTCTTCGTCAGCCTCCCTTCC Reverse:GAGTCGCAGAGCCGTGAGC , Sangon Biotech , N/A.

Techniques: Biomarker Discovery, Binding Assay, Solvent